Pennock's Fiero Forum
  Totally O/T - Archive
  Bizarre Conversion Project for FieroRumor

T H I S   I S   A N   A R C H I V E D   T O P I C
  

Email This Page to Someone! | Printable Version


Bizarre Conversion Project for FieroRumor by zardoz
Started on: 08-03-2006 07:39 PM
Replies: 4
Last post by: zardoz on 08-04-2006 09:54 AM
zardoz
Member
Posts: 1284
From: Tennessee
Registered: Sep 2003


Feedback score: N/A
Leave feedback

Rate this member

Report this Post08-03-2006 07:39 PM Click Here to See the Profile for zardozSend a Private Message to zardozDirect Link to This Post
OK, so I know you have seen the "01001100" binary thread and such.

And I know you brilliantly devised the fogglethorpe decoder.

So heres the gist of the idea.

First you convert your text into base 4 math, like we were converting to binary, octal, hex, and such. I have searched, and couldn't find an ASCII to base 4 math converter. A message would end up looking like this "103020100203010" or something similar.

Now you assign one of four letter combinations to 0,1,2, and 3. The letters are well known. A, C, G, and T. Its the DNA nucleotides. Except that they can only occur in pairs. AT, TA, CG, GC are the only pairs possible. So for this example, 0=AT, 1=TA, 2=CG, and 3=GC.

Most have seen the DNA sequencing strings such as "ATCGCGTACG" and so on.

So the idea is to encode a text message first to base 4, then to the nucleotide pairs so that it appears as if it is a segment of DNA.

I will let you now speculate on the possibilities here. Interested?

(Implanting secret messages in mantis DNA.........hmmmmm.)
IP: Logged
PFF
System Bot
ryan.hess
Member
Posts: 20784
From: Orlando, FL
Registered: Dec 2002


Feedback score: (1)
Leave feedback





Total ratings: 319
Rate this member

Report this Post08-03-2006 07:42 PM Click Here to See the Profile for ryan.hessSend a Private Message to ryan.hessDirect Link to This Post
AGTCGGCCTAAGCTAAGCCTAGCTAGCTCAGTTCCAGGATCCGAACTGATCCGACTAG
CTAGCTAACTGATCCAGATCGAATCGATTCGATAGCTAAGCTTCCCAACGTAGCCTAGC

PS - ACCGTG!! haha!
IP: Logged
lurker
Member
Posts: 12355
From: salisbury nc usa
Registered: Feb 2002


Feedback score: N/A
Leave feedback





Total ratings: 236
Rate this member

Report this Post08-03-2006 07:43 PM Click Here to See the Profile for lurkerSend a Private Message to lurkerDirect Link to This Post
 
quote
Originally posted by zardoz:
"ATCGCGTACG"
(Implanting secret messages in mantis DNA.........hmmmmm.)

that's the greyhound-bus-sized, laser-beam eyed, intelligent mutation. dont fall for it rumor!
IP: Logged
FieroRumor
Member
Posts: 35007
From: New York
Registered: Dec 2001


Feedback score: (2)
Leave feedback





Total ratings: 348
Rate this member

Report this Post08-03-2006 11:57 PM Click Here to See the Profile for FieroRumorClick Here to visit FieroRumor's HomePageSend a Private Message to FieroRumorDirect Link to This Post
How did I miss this thread?

Um... explain that again, when I'm more "there"

Cuz' right now, I'm NOT...
Don't see why I couldn't DO it, just need the proper motivation...

Like Ford said, Anythin' s possible, when ya cut it down into little steps...

Do me a favor, and PM me in a month, maybe we'll work on it, My mental processes will be tied up till then.

[This message has been edited by FieroRumor (edited 08-04-2006).]

IP: Logged
zardoz
Member
Posts: 1284
From: Tennessee
Registered: Sep 2003


Feedback score: N/A
Leave feedback

Rate this member

Report this Post08-04-2006 09:54 AM Click Here to See the Profile for zardozSend a Private Message to zardozDirect Link to This Post
 
quote
Originally posted by FieroRumor:

Do me a favor, and PM me in a month, maybe we'll work on it, My mental processes will be tied up till then.



Fair enough. I am was half kidding anyway. Got to really thinking about this, so I googled some DNA synthesizers, and some gene sequencers. Holy poop-it-all!! I could get a used DNA synthesizer if I sold my cars, but the gene sequencer would take my house AND my retirement fund just to get a down payment. Not to mention all the licenses and stuff. Apparently our FDA does not want just anybody messing around with this kind of thing. Probably a good thing, since Lurker warned of "accidents". Godzilla mantis' running around would not be a favorable outcome in any possible future I would think.

So for now, just a novel idea for maybe a cool sci-fi book. Maybe Michael Crichton could meet with Arthur C. Clarke, and perhaps the ghost of Carl Sagan to come up with a real mind blower of a story.
IP: Logged



All times are ET (US)

T H I S   I S   A N   A R C H I V E D   T O P I C
  

Contact Us | Back To Main Page

Advertizing on PFF | Fiero Parts Vendors
PFF Merchandise | Fiero Gallery
Real-Time Chat | Fiero Related Auctions on eBay



Copyright (c) 1999, C. Pennock