OK, so I know you have seen the "01001100" binary thread and such.

And I know you brilliantly devised the fogglethorpe decoder.

So heres the gist of the idea.

First you convert your text into base 4 math, like we were converting to binary, octal, hex, and such. I have searched, and couldn't find an ASCII to base 4 math converter. A message would end up looking like this "103020100203010" or something similar.

Now you assign one of four letter combinations to 0,1,2, and 3. The letters are well known. A, C, G, and T. Its the DNA nucleotides. Except that they can only occur in pairs. AT, TA, CG, GC are the only pairs possible. So for this example, 0=AT, 1=TA, 2=CG, and 3=GC.

Most have seen the DNA sequencing strings such as "ATCGCGTACG" and so on.

So the idea is to encode a text message first to base 4, then to the nucleotide pairs so that it appears as if it is a segment of DNA.

I will let you now speculate on the possibilities here. Interested?

(Implanting secret messages in mantis DNA.........hmmmmm.)

AGTCGGCCTAAGCTAAGCCTAGCTAGCTCAGTTCCAGGATCCGAACTGATCCGACTAG
CTAGCTAACTGATCCAGATCGAATCGATTCGATAGCTAAGCTTCCCAACGTAGCCTAGC

PS - ACCGTG!! haha!

quote Originally posted by zardoz: "ATCGCGTACG" (Implanting secret messages in mantis DNA.........hmmmmm.)

that's the greyhound-bus-sized, laser-beam eyed, intelligent mutation. dont fall for it rumor!

How did I miss this thread?

Um... explain that again, when I'm more "there"

Cuz' right now, I'm NOT...
Don't see why I couldn't DO it, just need the proper motivation...

Like Ford said, Anythin' s possible, when ya cut it down into little steps...

Do me a favor, and PM me in a month, maybe we'll work on it, My mental processes will be tied up till then.

[This message has been edited by FieroRumor (edited 08-04-2006).]

quote Originally posted by FieroRumor: Do me a favor, and PM me in a month, maybe we'll work on it, My mental processes will be tied up till then.

Fair enough. I am was half kidding anyway. Got to really thinking about this, so I googled some DNA synthesizers, and some gene sequencers. Holy poop-it-all!! I could get a used DNA synthesizer if I sold my cars, but the gene sequencer would take my house AND my retirement fund just to get a down payment. Not to mention all the licenses and stuff. Apparently our FDA does not want just anybody messing around with this kind of thing. Probably a good thing, since Lurker warned of "accidents". Godzilla mantis' running around would not be a favorable outcome in any possible future I would think.

So for now, just a novel idea for maybe a cool sci-fi book. Maybe Michael Crichton could meet with Arthur C. Clarke, and perhaps the ghost of Carl Sagan to come up with a real mind blower of a story.